|
MathWorks Inc
varx models Varx Models, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/varx models/product/MathWorks Inc Average 93 stars, based on 1 article reviews
varx models - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
STATA Corporation
logistic regression model with random effects Logistic Regression Model With Random Effects, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/logistic regression model with random effects/product/STATA Corporation Average 90 stars, based on 1 article reviews
logistic regression model with random effects - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Plotly Technologies Inc
plot_ly Plot Ly, supplied by Plotly Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plot_ly/product/Plotly Technologies Inc Average 90 stars, based on 1 article reviews
plot_ly - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
rna oligos var var3 u- c var3,4 ua4au var6 u4c var10 c4a auauauuaauauauauacuu ns Rna Oligos Var Var3 U C Var3,4 Ua4au Var6 U4c Var10 C4a Auauauuaauauauauacuu Ns, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna oligos var var3 u- c var3,4 ua4au var6 u4c var10 c4a auauauuaauauauauacuu ns/product/Oligos Etc Average 90 stars, based on 1 article reviews
rna oligos var var3 u- c var3,4 ua4au var6 u4c var10 c4a auauauuaauauauauacuu ns - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
varx model estimation ![]() Varx Model Estimation, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/varx model estimation/product/MathWorks Inc Average 90 stars, based on 1 article reviews
varx model estimation - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
implementation of the varx model ![]() Implementation Of The Varx Model, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/implementation of the varx model/product/MathWorks Inc Average 90 stars, based on 1 article reviews
implementation of the varx model - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Van Wingerden International
varx model ![]() Varx Model, supplied by Van Wingerden International, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/varx model/product/Van Wingerden International Average 90 stars, based on 1 article reviews
varx model - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
varx(1) model ![]() Varx(1) Model, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/varx(1) model/product/MathWorks Inc Average 90 stars, based on 1 article reviews
varx(1) model - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Raytec Systems Inc
ir illuminators var2-i2-1 ![]() Ir Illuminators Var2 I2 1, supplied by Raytec Systems Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ir illuminators var2-i2-1/product/Raytec Systems Inc Average 90 stars, based on 1 article reviews
ir illuminators var2-i2-1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Varex Imaging
varex tube ![]() Varex Tube, supplied by Varex Imaging, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/varex tube/product/Varex Imaging Average 90 stars, based on 1 article reviews
varex tube - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Varex Imaging
versaprep ![]() Versaprep, supplied by Varex Imaging, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/versaprep/product/Varex Imaging Average 90 stars, based on 1 article reviews
versaprep - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GENETYX CORPORATION
genetyx-mac ![]() Genetyx Mac, supplied by GENETYX CORPORATION, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genetyx-mac/product/GENETYX CORPORATION Average 90 stars, based on 1 article reviews
genetyx-mac - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLOS ONE
Article Title: VARX Granger analysis: Models for neuroscience, physiology, sociology and econometrics
doi: 10.1371/journal.pone.0313875
Figure Lengend Snippet: VARX model: The gray box represents the overall system response H .
Article Snippet:
Techniques:
Journal: PLOS ONE
Article Title: VARX Granger analysis: Models for neuroscience, physiology, sociology and econometrics
doi: 10.1371/journal.pone.0313875
Figure Lengend Snippet: A total of 43.6 minutes of data was used at a sampling rate of 60 Hz ( T = 156, 955) from a single patient. (A) Effect size R for the recurrent connectivity A between recording electrodes—in the language of neuroscience, this could be called “functional connectivity”. (B) Effect size R of fixation onset as an exogenous variable on different electrodes. (C) A filter coefficients ( n a = 4). (D) B filter coefficients n b = 30 , n _ = 20 . (E) System response estimated as a multivariate MA filter—in the language of neuroscience, this is the multivariate “temporal response function” (mTRF). (F) System response resulting from the VARX model estimate . Data from .
Article Snippet:
Techniques: Sampling, Functional Assay
Journal: PLOS ONE
Article Title: VARX Granger analysis: Models for neuroscience, physiology, sociology and econometrics
doi: 10.1371/journal.pone.0313875
Figure Lengend Snippet: Example on union participation and strikes: (A) Historical data from the US. We treated the unemployment rate as an exogenous input in the VARX model, and the others as endogenous variables. (B) Significant effects in A and B are indicated in blue and red, respectively ( p < 0.05, n a = n b = 3, T = 195). Note missing data around 1980, which was omitted during the estimation, including a 3-year history.
Article Snippet:
Techniques:
Journal: The Journal of Biological Chemistry
Article Title: Structure-Function Analysis of VPS9-Ankyrin-repeat Protein (Varp) in the Trafficking of Tyrosinase-related Protein 1 in Melanocytes
doi: 10.1074/jbc.M110.191205
Figure Lengend Snippet: All four ANK repeats are required for the Rab32/38 binding activity of the Varp ANKR1 domain. A, schematic representation of the truncated mutants of the ANKR1 domain of Varp used in this study. ANKR1-1 contains amino acid residues 462–494; ANKR1-2 contains amino acid residues 495–527; ANKR1-3 contains amino acid residues 528–560; and ANKR1-4 contains amino acid residues 561–596. ANKR1-Δ1 lacks amino acid residues 462–494 (Δ462–494); ANKR1-Δ2 lacks amino acid residues 495–527 (Δ495–527); ANKR1-Δ3 lacks amino acid residues 528–560 (Δ528–560); and ANKR1-Δ4 lacks amino acid residues 561–596 (Δ561–596). B, yeast two-hybrid assays revealed that all four ANK repeats in the ANKR1 are required for Rab32/38 binding. Yeast cells containing pAct2 plasmid expressing each Varp-ANKR1 mutant and pGBD plasmid expressing Rab32 mutant (left panels) or Rab38 mutant (right panels) were streaked on SC-LW (top panels) and SC-AHLW (bottom panels) and incubated at 30 °C. Note that none of the ANKR1 deletion mutants of Varp grew on SC-AHLW (i.e. selection medium) but that they grew normally on SC-LW.
Article Snippet: Sequence alignment of the switch II region of mouse or human Rabs or of each ANK repeat in the ANKR1 domain of
Techniques: Binding Assay, Activity Assay, Plasmid Preparation, Expressing, Mutagenesis, Incubation, Selection
Journal: The Journal of Biological Chemistry
Article Title: Structure-Function Analysis of VPS9-Ankyrin-repeat Protein (Varp) in the Trafficking of Tyrosinase-related Protein 1 in Melanocytes
doi: 10.1074/jbc.M110.191205
Figure Lengend Snippet: Identification of the critical residues responsible for Rab32/38 binding in the ANKR1 domain of Varp by site-directed mutagenesis. A, sequence alignment of the ANKR1 domain of human (Hs, Homo sapiens), mouse (Mm, Mus musculus), chick (Gg, Gallus gallus), zebra fish (Dr, Danio rerio), sea urchin (Sp, Strongylocentrotus purpuratus), and silkworm (Bm, Bombyx mori) Varp. Residues conserved in more than five of the sequences are shown against a black background. The asterisks indicate the positions of the seven highly conserved amino acids, Gln-509, Cys-544, Lys-546, Tyr-550, Arg-557, Trp-575, and Tyr-577, in the ANKR1 domain that were the focus of the Ala-based site-directed mutagenesis. B, yeast two-hybrid assays revealed that the Gln-509 and Tyr-550 of Varp are critical for Rab32/38 binding. Yeast cells containing pGAD plasmid expressing Varp and pGBD plasmid expressing Rab32 (left panels) or Rab38 (right panels) were streaked on SC-LW (top panels) and SC-AHLW (selection medium; bottom panels) and incubated at 30 °C. Note that the Q509A, Y550A, W575A, and Y577A mutations dramatically reduced Rab32/38 binding activity, although the former two mutations reduced Rab32/38 binding activity more severely than the latter two mutations, based on the growth rate of the yeast cells and the results of the immunofluorescence analysis (see Fig. 6 and supplemental Fig. S4A). By contrast, the C544A, K546A, and R557A mutations had little or no effect on Rab32/38 binding. C, FLAG-tagged Rab32/38 and T7-tagged Varp-full or their mutants were co-expressed in COS-7 cells, and their associations were analyzed in the presence of 0.5 mm GTPγS by co-immunoprecipitation assays with anti-FLAG tag antibody-conjugated agarose beads as described previously (24). Co-immunoprecipitated T7-tagged Varp-full (or their mutants) (middle panels) and immunoprecipitated FLAG-tagged Rab32/38 (bottom panels) were detected with HRP-conjugated anti-FLAG tag antibody and HRP-conjugated anti-T7 tag antibody, respectively. Input means 1/70 volume of the reaction mixture used for immunoprecipitation (IP) (top panels). The positions of the molecular mass markers (in kilodaltons) are shown on the left. Note that neither Varp(Q509A) nor Varp(Y550A) bound Rab32/38 (lanes 3 and 4 in the middle panel), whereas Varp(R557A) normally bound Rab32/38 (lane 5 in the middle panel), consistent with the results of the yeast two-hybrid assays shown in B.
Article Snippet: Sequence alignment of the switch II region of mouse or human Rabs or of each ANK repeat in the ANKR1 domain of
Techniques: Binding Assay, Mutagenesis, Sequencing, Plasmid Preparation, Expressing, Selection, Incubation, Activity Assay, Immunofluorescence, Immunoprecipitation, FLAG-tag